May/June 2015

Which units would be suitable for measuring the diameters of alveoli, the diameters of white blood cells and the thickness of cell walls?

The microscope in cell studies

Which statement correctly describes the structure of amylose and cellulose?

Carbohydrates and lipids

Which description is accurate?

Cells as the basic units of living organisms

Polar molecules are able to form hydrogen bonds with one another. Which properties of water are caused by the polarity of its molecules?

Water

Which statements about the effect of all enzyme inhibitors are correct?

Factors that affect enzyme action

The graphs illustrate the rate of an enzyme-catalysed reaction. Which graph shows the effect of increasing the concentration of the substrate at two concentrations of a competitive inhibitor?

Factors that affect enzyme action

What kind of cell has a large number of glycoproteins on its cell surface membrane?

Fluid mosaic membranes

The diagram illustrates ion movement across the cell surface membrane. Within the cell, the concentration of sodium ions ($\text{Na}^+$) is low and the concentration of potassium ions ($\text{K}^+$) is high. Outside the cell, there is a low concentration of $\text{K}^+$ and a high concentration of $\text{Na}^+$. The carrier molecule acts as a pump that swaps $\text{Na}^+$ for $\text{K}^+$. Which ionic movements do the arrows show?

Movement into and out of cells

Which combination of factors will result in the highest fluidity of the cell surface membrane?

Fluid mosaic membranes

The graphs display a range of measurements recorded from metaphase of mitosis onwards. They are drawn to scale relative to each other. Which row correctly names each graph?

Chromosome behaviour in mitosis

A scientist observed that each root cell in a xerophytic plant contained 22 chromosomes. What are the diploid and haploid chromosome numbers for this species?

Replication and division of nuclei and cells

The diagram presents a high-power drawing of a bacterium. Which three components are present in both this bacterium and an animal cell?

Cells as the basic units of living organisms

Which row shows the two nucleotide pairs produced during transcription?

Proteins

Which row accurately identifies the characteristics of DNA and RNA molecules?

Structure of nucleic acids and replication of DNA

A DNA molecule is composed of two polynucleotide strands. Which description is correct?

Structure of nucleic acids and replication of DNA

The diagram presents transverse sections of two plant structures. Which row gives the correct labels?

Structure of transport tissues

A tissue made up of plasmolysed plant cells was placed in distilled water. The graph shows how mean cell volume varies with time. What causes the plateau at X?

Movement into and out of cells

The diagram illustrates a vascular bundle from the stem of a plant. Which row identifies the functions of the labelled cells?

Structure of transport tissues

What changes happen to the water potential and the volume of liquid in the phloem when amino acids are transported into a sink from phloem sieve tubes?

Movement into and out of cells

The graph illustrates the oxygen dissociation curves for haemoglobin taken from three different animals. Which of haemoglobins X, Y or Z would be found in each of animals 1, 2 or 3? 1 an adult human 2 a fish living in water with a very low oxygen concentration 3 a very active mammal whose tissues have a much higher rate of respiration than an adult human

Proteins

What accounts for oxygen uptake being maximised as blood flows through the capillaries in the lungs?

Movement into and out of cells

What occurs once carbonic anhydrase has catalysed a reaction involved in the transport of carbon dioxide?

Mode of action of enzymes

The diagram depicts a stage micrometer scale, with its small divisions seen via an eyepiece that contains a graticule. The stage micrometer scale is then replaced with a slide of a plant cell. What is the width of a chloroplast?

The microscope in cell studies

The diagram shows a cross-section of the heart and the linked blood vessels. Which statement about the movement of blood through the heart is correct?

The heart

Which row identifies the function of each named tissue in the gas exchange system?

The gas exchange system

The graph presents the findings of a study designed to find out whether a relationship exists between the number of cigarettes smoked by a mother and the birth weight of her baby. Which conclusions may be made from this graph? 1 As the number of cigarettes smoked rises, the baby's weight always falls. 2 Other factors besides smoking influence a baby's birth weight. 3 Nicotine, tar and carbon monoxide reduce the growth of an unborn baby. 4 Most smokers smoke between 10 and 35 cigarettes per day.

Transport of oxygen and carbon dioxide

What is one characteristic of coronary bypass surgery?

The heart

The table’s first column lists statements about disease. The columns labelled 1, 2, 3 and 4 represent four different named diseases. What is the correct set of column headings for the table shown above?

Infectious diseases

For malaria, which row is correct?

Infectious diseases

While a highly contagious disease is spreading, people who are at risk require protection straight away. Which type of immunity should be provided to these people?

Proteins

Which cells develop into memory cells in the immune response?

The immune system

Which soil would contain the fewest denitrifying bacteria?

Cells as the basic units of living organisms

Within an ecosystem, during which stage is the greatest amount of energy lost?

Transport of oxygen and carbon dioxide

Which structures are present in typical eukaryotic cells?

Cells as the basic units of living organisms

Two animal species live in the same forest-and-grassland region. During spring and summer, both feed on the same plant material. Yet in autumn and winter, one species consumes nuts in the forest, while the other feeds on roots in the grassland. The same predator hunts both species. The numbers of the root-feeding animals are reduced the most by this predator, but they recover more quickly because they reproduce at a faster rate. What conclusion can be drawn about these two animal species?

The microscope in cell studies

What is the role of the nucleolus?

Protein synthesis

The electron micrograph shows a cell at a magnification of $\times 5700$. What is the nucleus’s actual diameter?

The microscope in cell studies

A student performed four tests for biological molecules on a solution. The results are given in the table. iodine solution: orange biuret: purple Benedict’s: orange emulsion: cloudy Which molecules could be present in this solution?

Testing for biological molecules

The diagrams illustrate several kinds of bond present in biological molecules. Which combination of bonds would not be present in a protein with tertiary structure?

Proteins

Which row correctly pairs the descriptions of biological molecules with where they are found? 1 a linear polymer made from 1,4 linked $\beta$-glucose molecules 2 a bipolar, phosphate containing molecule 3 a highly branched polymer made from 1,4 and 1,6 linked $\alpha$-glucose molecules

Carbohydrates and lipids

What diameter does a typical plant cell have?

Cells as the basic units of living organisms

Which bonds are responsible for holding the structure of cellulose together?

Carbohydrates and lipids

What type of bonds are present in glycogen?

Carbohydrates and lipids

Biological molecule solutions are checked for sugars. The table shows the colours of the solutions after the test. Which one may contain non-reducing sugars?

Testing for biological molecules

Which levels of protein structure are invariably involved when competitive and non-competitive inhibitors attach to enzymes?

Mode of action of enzymes

Which of the following statements about the optimum temperature of all enzymes are correct?

Factors that affect enzyme action

Which statement correctly describes the permeability of the cell surface membrane?

Fluid mosaic membranes

The diagram shows a cell surface membrane. Three routes across the membrane are illustrated. Which process does each arrow show?

Movement into and out of cells

Which combination of factors will result in the most fluid cell surface membrane?

Fluid mosaic membranes

The protein p53 is synthesised in a cell when DNA damage occurs. A scientist exposed three sets of cells, X, Y and Z, to different conditions. In which sets of cells would the scientist expect to find large amounts of p53 mRNA?

Replication and division of nuclei and cells

Which row is the correct one?

Testing for biological molecules

A specimen is observed through a microscope with green light of wavelength $510\,\text{nm}$. Suppose the same specimen is then observed again in identical conditions, except that red light of wavelength $650\,\text{nm}$ is used instead. What happens to the microscope’s magnification and resolution?

The microscope in cell studies

What is necessary for DNA to be transcribed?

Mode of action of enzymes

In a ribosome, which type of bond links two neighbouring amino acids together?

Proteins

The diagram illustrates part of a DNA molecule. What number of hydrogen bonds are present in keeping these DNA strands joined together?

Structure of nucleic acids and replication of DNA

What characteristics of these cells make them suitable for their function?

Cells as the basic units of living organisms

What is the order of events during the translocation of sucrose?

Movement into and out of cells

From which part does water evaporate during transpiration?

Transport mechanisms

What changes occur in the water potential and the volume of liquid in the phloem when amino acids are removed from a sink in a phloem sieve tube?

Movement into and out of cells

What reaction occurs in a capillary in the lungs?

Movement into and out of cells

Which structure has been identified correctly?

Cells as the basic units of living organisms

A resting muscle has a lower respiration rate than an active muscle. The graph displays dissociation curves for haemoglobin at carbon dioxide concentrations that occur in muscle and in an active muscle. P and Q are at the partial pressures of oxygen found in the lungs. R and S are at the partial pressures of oxygen found in either a resting muscle or an active muscle. Which statements are correct?

Proteins

What role do plasmodesmata play in plant cells?

Movement into and out of cells

Which of the following does not assist in maximising oxygen uptake as blood passes through the capillaries in the lungs?

Movement into and out of cells

Which statement correctly explains the function of elastic fibres in the lungs?

Proteins

The diagram shows a transverse section through the wall of a bronchus (not to scale). In a person who has chronic obstructive pulmonary disease (COPD), what occurs in each of the numbered structures?

The gas exchange system

The signs of two diseases are shown below. Disease 1: persistent cough; pain when breathing; loss of weight. Disease 2: shortness of breath; wheezing; fatigue. Which row matches diseases 1 and 2 correctly?

The microscope in cell studies

The graph illustrates the decrease in cases of tuberculosis (TB) in a country from 1910 to 2000. Which of the following factors may have helped cause this decrease during this time? 1 milk pasteurisation 2 the supply of new housing 3 chemical processing of sewage 4 tracing the contacts of people infected with TB

The microscope in cell studies

Which row about cholera is correct?

Infectious diseases

What action does an antigen-activated B-lymphocyte carry out?

Antibodies and vaccination

The production of specific antibodies following vaccination is an example of what type of immunity?

Proteins

At which stage in a tropical grassland food chain is energy transferred most inefficiently?

Transport mechanisms

A farmer cultivates a different crop in a field during each of the first three years. In the fourth year, he plants a leguminous crop, such as clover, and then ploughs it back into the soil. In the following year, he begins the rotation again. How does the crop grown in the fourth year add mineral ions to the soil?

Transport mechanisms

What size of ribosome occurs in both chloroplasts and mitochondria?

Protein synthesis

From the prey eaten by the lion, which box receives the greatest amount of energy?

Transport of oxygen and carbon dioxide

Which function corresponds to the description of the cell structure?

Cells as the basic units of living organisms

A ribosome has two subunits, and each subunit includes rRNA. When all the $70\text{S}$ ribosomes in one Escherichia coli cell were examined, the results showed $38\,000$ rRNA molecules, $2$ principal kinds of rRNA molecule, and $19\,000$ copies of each rRNA type. What number of $70\text{S}$ ribosomes were present in the E. coli cell?

Protein synthesis

What kind of bond keeps together an $\alpha$-helix or $\beta$-pleated sheet in a protein?

Proteins

Which option describes only the quaternary structure of haemoglobin?

Proteins

The statements concern the properties of water. What makes it possible for a small insect to stay on the surface of a pond?

Water

What structures are present in both mitochondria and typical prokaryotic cells?

Cells as the basic units of living organisms

Which properties of water are caused only by cohesion?

Water

The protein glutenin is what makes bread dough elastic. The diagram shows a polypeptide of glutenin. Which description matches the structure of glutenin?

Proteins

A student performed four tests to identify biological molecules. The results are listed below. Tests and observations: - iodine: orange - biuret: purple - Benedict’s: orange - emulsion: clear Which molecules are present in the solution?

Testing for biological molecules

Certain enzyme inhibitors attach to the enzyme-substrate complex. Which of the following statements correctly describe this form of inhibition?

Factors that affect enzyme action

The enzyme DNA polymerase functions in DNA replication. It was obtained from bacteria that inhabit natural hot water springs, where the water temperature lies between $85^{\circ}\text{C}$ and $95^{\circ}\text{C}$. Which graph would show the link between temperature and the rate of DNA replication when it is catalysed by the enzyme from these bacteria?

Factors that affect enzyme action

What evidence supports the idea that a membrane protein takes part in active transport?

Movement into and out of cells

The graph illustrates how raising the concentration of glucose in a solution affects the rate at which glucose enters a cell. Which of the following are not reasons for the plateau at X?

Movement into and out of cells

Which combination of factors would lead to the cell surface membrane having the lowest fluidity? In every option, the factors named are shown as having increased.

Fluid mosaic membranes

The diagrams illustrate chromosomes at different stages of mitosis. Which diagram shows the cell cycle in the correct sequence?

Chromosome behaviour in mitosis

Which diagrams illustrate the correct relationships?

The microscope in cell studies

Which statements concerning light microscopes are correct?

The microscope in cell studies

Which row gives the correct description of adenine?

Structure of nucleic acids and replication of DNA

Which row identifies two nucleotide pairs formed during translation of mRNA?

Proteins

Sickle cell anaemia results from a mutation in an allele of the gene that encodes the β-globin polypeptide in haemoglobin. The diagram below shows the base sequence in a short section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA: CTGACTCCTGAGGAGAAGTCT HbS: CTGACTCCTGTGGAGAAGTCT How will the mutation in the HbS allele lead to the synthesis of an altered β-globin polypeptide?

Proteins

Which force keeps water molecules attached to the surface of cell walls?

Water

The following statements concern the properties of water. 1. needs a lot of heat in order to evaporate 2. retains a large amount of heat 3. can form hydrogen bonds with other water molecules 4. can form hydrogen bonds with other polar molecules Which properties are important for translocation in phloem?

Water

What changes occur to water potential and to the volume of liquid in the phloem when amino acids are transported into a phloem sieve tube at a source?

Movement into and out of cells

Which aspect of transport in xylem relies on the use of energy?

Movement into and out of cells

What is accurate about the transport of carbon dioxide by blood? 1. The enzyme carbonic anhydrase speeds up the production of carbonic acid in red blood cells. 2. Carbon dioxide moves by diffusion from respiring cells to red blood cells and combines with water. 3. Carbonic acid dissociates to produce hydrogen ions, which join with haemoglobin to make carbaminohaemoglobin.

Movement into and out of cells

The graph illustrates how varying partial pressures of carbon dioxide (CO$_2$) affect the dissociation curve of haemoglobin. What is the difference in percentage oxygen saturation of haemoglobin at a partial pressure of oxygen of $6\,\text{kPa}$ when the partial pressure of carbon dioxide changes from $1.0\,\text{kPa}$ to $1.5\,\text{kPa}$?

Proteins

Which structures carry deoxygenated blood?

The microscope in cell studies

Which of the following comparisons between a phloem companion cell and a B-lymphocyte is correct?

Cells as the basic units of living organisms

Which effect might be caused by a lower concentration of carbonic anhydrase?

Factors that affect enzyme action

Which row shows nicotine’s effects on the body when it is present in tobacco smoke?

The heart

Lung cancer and chronic obstructive pulmonary disease (COPD) have several symptoms in common. Which symptom is characteristic of lung cancer but not COPD?

Replication and division of nuclei and cells

A person inhales tiny particles while in an extremely dusty environment. What effect will this have on B-lymphocytes and goblet cells?

The immune system

The diagram presents characteristics of diseases. Which one shows the characteristics shared by both tuberculosis (TB) and measles?

Infectious diseases

Certain strains of Mycobacterium have been identified as: • multiple drug-resistant (MDR) - resistant to the drugs most frequently used to control tuberculosis (TB) • extensively drug-resistant (XDR) - resistant to the drugs most frequently used to control TB and to some of the drugs less frequently used to control TB • totally drug-resistant (TDR) - resistant to all known drugs used to control TB. When some of these Mycobacterium strains were compared, differences were seen in the thickness of their cell walls, as shown in the table. Mycobacterium: non-resistant $15\,\text{nm}$; MDR $17\,\text{nm}$; TDR $20\,\text{nm}$. What conclusions can be drawn from this information?

Antibiotics

What is meant by natural passive immunity?

Antibodies and vaccination

What occurs when people are injected with dead bacteria?

The microscope in cell studies

The diagram shows part of the nitrogen cycle. Which process do nitrifying bacteria carry out?

Cells as the basic units of living organisms

A primary consumer, X, is removed from a community because of a fatal viral infection. Later, the population sizes of some of the organisms in the food web alter. Which population of organisms went up?

The microscope in cell studies

Ribosomes are found as distinct subunits that join up during protein synthesis. What are these subunits made up of?

Protein synthesis

The table presents the findings from a field study of four species in a food chain in a given area. Which pyramid of energy is correct based on these data?

Transport mechanisms

Which structures in plant cells are enclosed by a double membrane?

Cells as the basic units of living organisms

What is the diameter of a typical prokaryote, for example Streptococcus?

Cells as the basic units of living organisms

Which one of the molecules is $\alpha$-glucose?

Carbohydrates and lipids

The diagram illustrates the three-dimensional structure of collagen. Which labelled part shows a molecule of collagen?

Proteins

Which type of bond is not involved in maintaining the tertiary structure of a protein?

Proteins