Sickle cell anaemia results from a mutation in an allele of the gene that encodes the β-globin polypeptide in haemoglobin. The diagram below shows the base sequence in a short section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA: CTGACTCCTGAGGAGAAGTCT HbS: CTGACTCCTGTGGAGAAGTCT How will the mutation in the HbS allele lead to the synthesis of an altered β-globin polypeptide?
- AA tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA.
- BAll the amino acids coded for after the mutation will differ from those in the HbA protein.
- CmRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC.
- DThe ribosome will be unable to continue translation of the HbS mRNA after the altered codon.