Biology 9700 · AS & A Level

Oct/Nov 2023

120 questions from this paper, with worked solutions and instant marking.

Before recently, the viruses most commonly recognised by scientists had sizes of $20\text{-}150\,\text{nm}$. The Mimivirus was discovered in 2003 and had a size of approximately $680\,\text{nm}$. The Pandoravirus was discovered in 2013 and has a size of over $1000\,\text{nm}$. Which of these viruses can be observed with a light microscope that has a maximum resolution of $0.25\,\mu\text{m}$, and which require an electron microscope?

The microscope in cell studies

Which molecules would be present in an oil (liquid) in larger amounts than in a fat (solid)?

Carbohydrates and lipids

Which row correctly describes the bonding present in the primary, secondary, tertiary and quaternary structure of proteins?

Proteins

The specific heat capacities of several substances are given. Which statement is correct?

Water

On the graph, the solid curve shows the amount of product made over time in a reaction inside a cell. Which other curve shows the effect of adding the enzyme for this reaction?

Factors that affect enzyme action

The graph illustrates the effect of a change in temperature on the rate of an enzyme-controlled reaction. All other variables were kept constant. What factor is limiting the rate in region X?

Factors that affect enzyme action

In what way will removing a reversible non-competitive enzyme inhibitor affect an enzyme-catalysed reaction?

Factors that affect enzyme action

The measurements of three agar cylinders, X, Y and Z, are given in the table. In which sequence should the cylinders be arranged for the surface area : volume ratio, from the smallest to the largest?

Movement into and out of cells

Three separate plant leaf cells were each left in a different solution for 30 minutes. The solutions each had a different water potential. Which row shows correctly how the volume of the three cells changes after 30 minutes?

Movement into and out of cells

Which row shows a single chromosome at the start of prophase of mitosis, together with the number of DNA strands in that chromosome?

Chromosome behaviour in mitosis

Which stages are included in mitosis?

Chromosome behaviour in mitosis

The diagram presents an eyepiece graticule and a cell as seen with a microscope. At this magnification, when the eyepiece graticule was calibrated, the full length of the graticule shown spanned $12$ divisions on a stage micrometer scale. There were $100$ divisions in $10\,\text{mm}$ of the stage micrometer. What is the actual length of the cell?

The microscope in cell studies

The statements concern genes and proteins linked to breast cancer. • The protein produced by the BRAC1 gene prevents breast cancer cells from growing. • The protein produced by the p53 gene reduces tumour growth. Which pairing of genes is most likely to cause breast cancer?

Replication and division of nuclei and cells

The photomicrograph presents a cell in mitosis. What process is taking place in this cell?

Chromosome behaviour in mitosis

Which diagram accurately represents the structure of a DNA molecule?

Structure of nucleic acids and replication of DNA

Bacteria were cultured in a medium that contained $^{15}\text{N}$. After a number of generations, every bacterial DNA molecule contained $^{15}\text{N}$. Some of these bacteria were then moved into a medium containing the usual nitrogen isotope, $^{14}\text{N}$. They were allowed to undergo one division. DNA from some of these bacteria was removed and analysed. This DNA consisted entirely of hybrid DNA with equal quantities of $^{14}\text{N}$ and $^{15}\text{N}$. The rest of the bacteria remained in the $^{14}\text{N}$ medium and were allowed to divide once again. DNA from some of these bacteria was then extracted and analysed. What is the percentage of hybrid DNA?

Replication and division of nuclei and cells

Which statements accurately describe the process of transcription?

Proteins

Sickle cell anaemia arises from a mutation in an allele of the gene that codes for the $\beta$-globin polypeptide of haemoglobin. The diagram gives the base sequence in a short section of the template strand of DNA for both the Hb$^{A}$ (normal) and Hb$^{S}$ (sickle cell) $\beta$-globin alleles. Hb$^{A}$: CTGACTCCTGAGGAGAAGTCT Hb$^{S}$: CTGACTCCTGTGGAGAAGTCT The polypeptides produced by Hb$^{A}$ and Hb$^{S}$ have the same length. In what way will the mutation in the allele lead to the production of an altered form of the $\beta$-globin polypeptide?

Proteins

A student produced the plan diagram of a transverse section through a dicotyledonous plant stem. The section had been treated with a chemical that stains lignin. Which row shows the correct tissues W and Z?

Structure of transport tissues

Along which pathways does water move in a plant when the symplast pathway is used?

Movement into and out of cells

A plant leaf examined in transverse section using a microscope has the following features: - a thick waxy cuticle on the upper surface - sunken stomata on the lower surface - the leaf is rolled, so the edges curl inward What is this leaf adapted for?

Transport mechanisms

What happens when carbohydrate is moved from a sink into a phloem sieve tube element?

Movement into and out of cells

Tay-Sachs disease causes lipids to accumulate inside cells. Which cell structure fails to work properly in this disease?

Cells as the basic units of living organisms

Which factors influence blood pressure?

The microscope in cell studies

Sulthiamine is a molecule that prevents carbonic anhydrase from working. What effect would sulthiamine have within a red blood cell in muscle tissue that is respiring at a high rate?

Factors that affect enzyme action

The partial pressure of oxygen in blood vessels from different parts of the body influences the percentage saturation of each haemoglobin molecule with oxygen. Blood vessel data: - vein from active muscle: partial pressure of oxygen $4\,\text{kPa}$, saturation $25\%$ - vein from resting muscle: partial pressure of oxygen $7\,\text{kPa}$, saturation $75\%$ - arteriole in lungs: partial pressure of oxygen $12\,\text{kPa}$, saturation $100\%$ Which statement explains the difference in saturation between active muscle and resting muscle?

Proteins

Which statements concerning the Bohr shift are correct?

Proteins

A number of events that occur in a cardiac cycle are given below. 1. The left and right atria contract. 2. The left and right ventricles contract. 3. A wave of electrical activity is carried by the Purkyne tissue. 4. A wave of electrical activity travels through the atrioventricular node. What is the correct order of events after the sinoatrial node releases a wave of electrical activity?

The heart

Oxygen and carbon dioxide move into and out of the blood within the capillaries surrounding the alveoli. Which statement about this process is correct?

Movement into and out of cells

Which statement is right?

Cells as the basic units of living organisms

The graph illustrates how the antibiotic resistance of a bacterium species changed from 2000 to 2016 in one country. Each year, bacteria samples were taken from 48 hospitals. The bacteria were then examined to determine whether they were resistant to five different antibiotics. What conclusion can be drawn from the data shown in the graph?

Antibiotics

A number of responses made by cells of the immune system to a pathogen are listed. Which of these responses are correct for B-lymphocytes?

The immune system

Which of the statements concerning the uses of monoclonal antibodies are correct?

Proteins

Which animal cells would contain the most extensive Golgi bodies?

Cells as the basic units of living organisms

Which statement describes how a vaccination programme can reduce the spread of an infectious disease in a population?

Proteins

The diagram displays three circles, $1$, $3$ and $5$, together with the shared structures, $2$ and $4$. Which row correctly identifies the three circles and some of the structures that they share between them?

Cells as the basic units of living organisms

Which row gives the correct information about the genetic material in animal cells and prokaryotic cells?

Structure of nucleic acids and replication of DNA

What is found in all viruses?

Proteins

To test for non-reducing sugars, a second Benedict’s test must be done. Which sequence of steps gives the correct procedure for testing for non-reducing sugar before performing the second Benedict’s test?

Testing for biological molecules

The diagrams illustrate three kinds of covalent bond. Which bonds would be present in glycolipids and glycoproteins?

Carbohydrates and lipids

Which lens combination in a light microscope produces the highest magnification?

The microscope in cell studies

How many of the statements about fatty acids are correct?

Carbohydrates and lipids

The diagram shows an amino acid. R stands for a variable side chain. Which side chain is not possible?

Proteins

The graph illustrates the influence of an enzyme on a reaction. Which row correctly identifies X, Y and Z?

Mode of action of enzymes

The graph presents the findings from two experiments investigating how raising substrate concentration affects the rate of an enzyme-catalysed reaction. In one experiment, the enzyme concentration was high, whereas in the other it was low. Every other variable was kept constant. What would be the limiting factor for the initial rate of reaction at point X?

Factors that affect enzyme action

Which of the following statements about an enzyme’s Michaelis-Menten constant ($K_m$) are correct?

Mode of action of enzymes

Which component in cell surface membranes helps decrease the fluidity of phospholipids at high temperatures?

Fluid mosaic membranes

Plant cells were kept for 50 minutes in three sugar solutions: 10%, 5% and 1%. At the start of the experiment, the water potential in the cytoplasm of the three cells was the same. The diagrams show what the cells looked like after 50 minutes, as seen with a light microscope. Which conclusion is correct?

Movement into and out of cells

The graph displays the impact of a larger side length for agar cubes on their surface area and volume. Which row gives the correct identification of line 1 and line 2, and of how increasing side length affects the surface area : volume ratio of the cubes?

Movement into and out of cells

At the beginning of day 1, a human embryo contains 12 cells. Over the next 4 complete days, the cells undergo mitosis at a rate of 1 division every 32 hours. What is the greatest possible number of cells in the embryo by the end of day 4?

Replication and division of nuclei and cells

Which diagrams illustrate the roles of mitosis?

Replication and division of nuclei and cells

The diagram presents an electron micrograph of virus particles in a human nucleus. What is the diameter of the virus particle labelled on the diagram?

The microscope in cell studies

From the events listed, which are included in the mitotic cell cycle? 1 interphase 2 anaphase 3 cytokinesis

Replication and division of nuclei and cells

Which statement accurately describes a feature of a DNA molecule?

Structure of nucleic acids and replication of DNA

Which diagram shows the replication of DNA correctly?

Replication and division of nuclei and cells

The RNA codon wheel is a reference chart for determining which amino acid will be translated from an mRNA sequence. Codon position 1 is at the centre of the wheel, codon position 2 is in the middle of the wheel and codon position 3 is close to the outer edge. The three letters around the outside edge of the wheel show the amino acid. The diagram displays part of DNA that codes for one amino acid. The template strand is shown inside a box and the DNA base sequence is read from $5'$ to $3'$. Which amino acid is coded by this section of DNA?

Proteins

Four students drew diagrams of the apoplast pathway and the symplast pathway. Which sketch is the most accurate representation of the two pathways?

Movement into and out of cells

This photomicrograph illustrates several xerophytic adaptations in leaf tissue. Which row gives the correct functions of structures 1, 2 and 3?

The gas exchange system

Which processes are needed to move assimilates from a source cell into a phloem sieve tube?

Movement into and out of cells

For sucrose to be loaded into the phloem, it must move from mesophyll cells into a companion cell and then on into the phloem. Which row gives the relative sucrose concentrations in each cell type so that this process can occur?

Movement into and out of cells

Which transport feature in plants is correct for xylem and phloem?

Movement into and out of cells

The diagram presents an anterior view of a vertical section through the human heart. Which row gives the correct labels for the diagram?

The microscope in cell studies

Which statement about how the glycoprotein mucin is synthesised and released in goblet cells is correct?

Movement into and out of cells

What is found in the inner layer of veins and capillaries?

The circulatory system

The graph illustrates how blood pressure and water potential vary along a blood capillary, from its arterial end to its venous end. What might lead to a build-up of excess tissue fluid?

Movement into and out of cells

Which statement is correct concerning a red blood cell that has just entered a capillary in a respiring muscle?

Movement into and out of cells

The graph illustrates some changes in blood pressure that take place in a human over one cardiac cycle. At what point does systole begin and finish in the right atrium and in the right ventricle?

The microscope in cell studies

Which of the following statements about all bronchioles are correct?

The gas exchange system

What does the electron micrograph show?

The microscope in cell studies

Which statement gives the correct description of infectious diseases?

Infectious diseases

Organism X makes molecule Y, and this molecule inhibits the activity of $70\text{S}$ ribosomes. An experiment was performed to examine the effect of Y on bacterial cells. An agar plate covered with bacteria growing across its entire surface had four wells made in the agar. Each well received a different substance, and the agar plate containing the bacteria was incubated for one week. The diagram shows the outcomes after one week. Which conclusions can be drawn from these results?

Antibiotics

A patient has experienced several infections caused by the same pathogen over a period of a few months. Each time, the patient has been given the same antibiotic. Which treatment could stop the pathogen from becoming more antibiotic-resistant?

Antibiotics

A patient whose kidneys have failed may receive a kidney transplant. In a kidney transplant, a healthy kidney is removed from another person and placed into the patient’s body. At times, the donated kidney cells are destroyed by the patient’s body. In this primary immune response, T-lymphocytes attach to antigens on the donated kidney cells and become activated. The statements below show the later stages of the primary immune response. 1 Activated T-lymphocyte secretes cytokines. 2 B-lymphocytes differentiate into plasma cells and make antibodies. 3 T-killer cells bind to antigens on donor kidney cells. 4 T-killer cells release toxins that destroy the donor kidney cells. 5 T-lymphocytes multiply by mitosis and differentiate into T-killer cells. Which sequence correctly shows how donor kidney cells are destroyed?

The immune system

What functions do microtubules have?

Cells as the basic units of living organisms

The diagram illustrates the simplified structure of an antibody. Which statement is correct?

Proteins

Which organelles have nucleic acids?

Structure of nucleic acids and replication of DNA

Some characteristics of cells are shown. Which of these characteristics are present in plant cells and in prokaryotic cells?

Cells as the basic units of living organisms

Which bonds occur in every virus?

Proteins

A student carried out Benedict’s test on four different concentrations of glucose solution and then noted how long it took for the first colour change to appear (the end-point). The student found it hard to spot the exact moment when the colour first changed and always continued timing each solution for two seconds after the colour change had first appeared. This introduced an error into the experiment. Which statements about this error are correct?

Testing for biological molecules

Which of the following statements about amylopectin and glycogen are correct?

Carbohydrates and lipids

Which statement concerning light microscopy is correct?

The microscope in cell studies

A triglyceride is formed from glycerol plus three different fatty acids: linoleic acid (L), oleic acid (O) and palmitic acid (P). The diagram illustrates one possible placement of the fatty acids L, O and P within the molecule. What is the total number of distinct placements of the fatty acids in this triglyceride?

Carbohydrates and lipids

Which statement concerning phospholipid molecules is correct?

Carbohydrates and lipids

Hydrogen bonding accounts for many of water’s properties, such as its high latent heat of vaporisation and high specific heat capacity. In which plant processes is hydrogen bonding in water important on hot sunny days?

Water

Which characteristic of cellulose molecules helps plant cell walls carry out their function?

Carbohydrates and lipids

Which statements describe some ways enzymes work?

Mode of action of enzymes

The influenza virus contains an enzyme named neuraminidase, which breaks down glycoproteins in the surface membrane of the host cell that the virus infects. The glycoprotein attaches to the active site of neuraminidase through induced fit. Which statements about the induced fit hypothesis of enzyme action are correct?

Mode of action of enzymes

The graph shows how temperature affects the activity of the protease enzyme papain, both in solution (free) and when immobilised in alginate beads. Which statement correctly describes the effect of immobilising papain?

Factors that affect enzyme action

The diagram illustrates how adrenaline triggers processes within a cell. Which row is the correct one?

Fluid mosaic membranes

The statements compare endocytosis with exocytosis. How many of the statements are correct?

Movement into and out of cells

A student was instructed to calculate the surface area : volume ratio of an agar cube with a side length of $5.5\,\text{mm}$. Which surface area : volume ratio is correct?

Movement into and out of cells

The diagram presents a stage micrometer scale as seen through an eyepiece fitted with a graticule. Each minor division on the stage micrometer scale measures $0.1\ \text{mm}$. The stage micrometer scale is then substituted with a slide of a plant cell. What is the maximum actual length of the nucleus in the plant cell?

The microscope in cell studies

During telophase, which statement correctly describes how chromosomes behave?

Chromosome behaviour in mitosis

The transmission electron micrograph displays a cell at one stage of the mitotic cell cycle. Which statement explains why it is hard to identify which stage of the mitotic cell cycle is shown?

Chromosome behaviour in mitosis

As the lagging strand is being replicated, small DNA fragments are formed. DNA ligase then joins these fragments together. Which row gives the correct description of the structure of these short DNA fragments?

Replication and division of nuclei and cells

The genome of the bacterium Escherichia coli has been modified so that it can specify an amino acid that does not occur naturally. Every ATC DNA stop triplet on the DNA strand that is transcribed has been changed to ATT. The ATC triplet can then be added so that it codes for the new amino acid. A new tRNA can then be made to carry the new amino acid. What is the anticodon of this new tRNA?

Proteins

In a section of the non-transcribed strand of DNA, 40% of the bases are purine molecules. What is the combined percentage of cytosine and uracil bases in the primary transcript made from the complementary DNA strand?

Protein synthesis

Of the statements about xylem vessel elements, which one is correct?

Structure of transport tissues

Ammonium ions, $\text{NH}_4^+$, may reach the xylem in plant roots by two routes: along the apoplast pathway, ammonium ions pass through cell walls until the Casparian strip blocks this route, after which they enter the cytoplasm of root cells; along the symplast pathway, ammonium ions travel through the cytoplasm of root cells. A scientist investigated the uptake of ammonium ions into the xylem of Arabidopsis thaliana. The sgn3 mutant of A. thaliana lacks a Casparian strip. In the sgn3 mutant, ammonium ions are able to enter the xylem without first entering the cytoplasm of root cells. The bar charts display the scientist’s findings. Which conclusion is correct?

Movement into and out of cells

Which row correctly identifies the processes needed for water to move from a root hair cell to the atmosphere?

Movement into and out of cells

Which process can a mature red blood cell carry out?

Movement into and out of cells

The photomicrograph contains three white blood cells labelled X, Y and Z. Which row gives the correct identification of these cells?

The microscope in cell studies

In what order do these cell structures take part in the synthesis and secretion of an enzyme? 1 cell surface membrane 2 Golgi body 3 nucleus 4 rough endoplasmic reticulum

Protein synthesis

If a blood vessel is damaged, this can cause problems in the body. Which row shows the blood vessel that may have been injured?

The microscope in cell studies

The diagram illustrates the formation of tissue fluid. What is the net pressure that drives tissue fluid out of the capillary at the arteriole end?

Movement into and out of cells

What occurs when carbon dioxide is carried by red blood cells?

Movement into and out of cells

What is usually present in the trachea, bronchi and bronchioles in the human gas exchange system?

The microscope in cell studies

The photomicrograph displays a section through part of the human gas exchange system. Which structure is being shown?

The microscope in cell studies

Which conditions are needed to allow oxygen and carbon dioxide to diffuse efficiently in the human gas exchange system?

Movement into and out of cells

Which statements correctly show why TB is hard to eliminate?

The microscope in cell studies

Bacteria may develop resistance to antibiotics. What action can help slow the emergence of antibiotic resistance in bacteria?

Antibiotics

The diagram illustrates one method for investigating how an antibiotic affects bacteria. Areas measuring less than $13.0\,\text{mm}$ indicate that resistant bacteria are present. Which statement can be justified by these data?

The microscope in cell studies

Some immune-system cell responses to a pathogen are shown. Which of these responses are correct for phagocytes?

Movement into and out of cells

Centrioles, cilia, microtubules and microvilli are all structures present in eukaryotic cells. Which statement about these cell structures is correct?

Cells as the basic units of living organisms

A few vaccines have no antigens in them. Instead, the vaccines contain a molecule of mRNA. Cells in the immune system use the mRNA molecule to synthesise a protein antigen. What is the correct sequence of the stages by which mRNA vaccines function?

Proteins

Which statement correctly describes plasmodesmata?

Movement into and out of cells

Which cell organelle contains no nucleic acids?

Cells as the basic units of living organisms

Which of these processes happen in eukaryotes and prokaryotes? 1 the process of hydrolysis 2 the process of mitosis 3 the process of transcription 4 the process of translation

Protein synthesis

Which bonds occur in all viruses? 1 covalent 2 ester 3 phosphodiester

Structure of nucleic acids and replication of DNA

The diagram illustrates the structure of a monomer. In which molecules is this monomer found?

Proteins