Biology 9700 · AS & A Level · Proteins

Proteins — practice question

Sickle cell anaemia arises from a mutation in an allele of the gene that codes for the $\beta$-globin polypeptide of haemoglobin. The diagram gives the base sequence in a short section of the template strand of DNA for both the Hb$^{A}$ (normal) and Hb$^{S}$ (sickle cell) $\beta$-globin alleles. Hb$^{A}$: CTGACTCCTGAGGAGAAGTCT Hb$^{S}$: CTGACTCCTGTGGAGAAGTCT The polypeptides produced by Hb$^{A}$ and Hb$^{S}$ have the same length. In what way will the mutation in the allele lead to the production of an altered form of the $\beta$-globin polypeptide?

  • AA tRNA molecule with the anticodon GUG will form hydrogen bonds with the altered codon on mRNA.
  • BAll the amino acids coded for after the mutation will differ from those in the Hb$^{A}$ protein.
  • CmRNA transcribed from the Hb$^{S}$ allele will contain the codon CAC instead of the codon CTC.
  • DThe ribosome will be unable to continue translation of the Hb$^{S}$ mRNA after the altered codon.

Worked solution & mark scheme

This 1-mark question has a full step-by-step worked solution and mark scheme.

  • Full mark scheme, point by point
  • Step-by-step worked solution
  • Write your answer & get it marked instantly by AI