Sickle cell anaemia arises from a mutation in an allele of the gene that codes for the $\beta$-globin polypeptide of haemoglobin. The diagram gives the base sequence in a short section of the template strand of DNA for both the Hb$^{A}$ (normal) and Hb$^{S}$ (sickle cell) $\beta$-globin alleles. Hb$^{A}$: CTGACTCCTGAGGAGAAGTCT Hb$^{S}$: CTGACTCCTGTGGAGAAGTCT The polypeptides produced by Hb$^{A}$ and Hb$^{S}$ have the same length. In what way will the mutation in the allele lead to the production of an altered form of the $\beta$-globin polypeptide?
- AA tRNA molecule with the anticodon GUG will form hydrogen bonds with the altered codon on mRNA.
- BAll the amino acids coded for after the mutation will differ from those in the Hb$^{A}$ protein.
- CmRNA transcribed from the Hb$^{S}$ allele will contain the codon CAC instead of the codon CTC.
- DThe ribosome will be unable to continue translation of the Hb$^{S}$ mRNA after the altered codon.