Oct/Nov 2019

Inside which cell structure is cytoplasm found?

Cells as the basic units of living organisms

Some features of triglycerides are given. Which of these characteristics make triglycerides suitable for storing energy?

Carbohydrates and lipids

Certain foods include hydrogenated vegetable oils. These are unsaturated fats that have been changed into saturated fats. Which property of the fats will have been altered?

Carbohydrates and lipids

Which statements could be used to describe enzyme molecules and antibody molecules?

Proteins

The $V_{\max}$ and $K_m$ are determined for an enzyme-catalysed reaction. What will be the effects on the $V_{\max}$ and $K_m$ when a competitive inhibitor is present?

Factors that affect enzyme action

The graph illustrates how the concentrations of components 1, 2, 3 and 4 in an enzyme-catalysed reaction vary over time. Which row correctly identifies the components in this reaction?

Mode of action of enzymes

Which statement indicates that a membrane protein is taking part in active transport?

Movement into and out of cells

Cell surface receptors involved in cell signalling are typically proteins that pass all the way through the membrane. What is the function of the part of the protein that lies outside the cell?

Fluid mosaic membranes

Which substances are able to move straight through cell surface membranes without using either a carrier protein or a channel protein?

Movement into and out of cells

A student placed a layer of plant epidermal cells onto a microscope slide. The student then added a drop of potassium nitrate solution to the cells and noticed that, in many of them, the cell surface membrane had pulled away from the cell wall, while the cytoplasm and cell contents had contracted. What accounts for these observations?

Movement into and out of cells

The enzyme telomerase stops telomeres being lost after many mitotic cell cycles. Which cells transcribe large amounts of telomerase?

Replication and division of nuclei and cells

Some cell structures are arranged in a specific sequence: 1 nucleus 2 ribosome 3 Golgi body 4 vesicle What factor decides the sequence in which these cell structures are arranged?

Protein synthesis

At what stage of mitosis do these events take place?

Chromosome behaviour in mitosis

Which components might be present in nucleotides of rRNA?

Structure of nucleic acids and replication of DNA

How many of these statements are correct for semi-conservative replication of DNA in a prokaryotic cell?

Replication and division of nuclei and cells

Sickle cell anaemia results from a mutation in an allele of the gene that specifies the $\beta$-globin polypeptide in haemoglobin. The diagram below shows the base sequence in a short section of the coding strand of DNA for both the $Hb^A$ (normal) and $Hb^S$ (sickle cell) $\beta$-globin alleles. $Hb^A$: CTGACTCCTGAGGAGAAGTCT $Hb^S$: CTGACTCCTGTGGAGAAGTCT How will the mutation in the allele cause production of an altered form of the $\beta$-globin polypeptide?

Proteins

The diagrams illustrate several tissue types found in plant organs. Which row correctly identifies the tissue types?

Structure of transport tissues

Which row gives the correct description of the adaptations of companion cells, phloem sieve tube elements and xylem vessel elements for their roles?

Structure of transport tissues

When crop plants are irrigated with water that has a low salt concentration, the salt concentration in the soil rises. Why could this rise in salt concentration eventually lead to the crop being killed?

Movement into and out of cells

The diagram illustrates the route taken by water through root cells to the xylem. Which cell lies in the endodermis?

Movement into and out of cells

Which row identifies the cause of mass flow in the phloem and the direction in which phloem sap moves by mass flow?

Transport mechanisms

Which statement is correct about oxygen joining with haemoglobin?

Proteins

This diagram was drawn from a section showing part of an alveolus and a red blood cell in a capillary. The magnification of the drawing is $\times 5000$. What is the shortest distance that oxygen has to diffuse from the air in an alveolus into the red blood cell?

Movement into and out of cells

The diagram illustrates the Bohr effect. What brings about the shift from X to Y?

Proteins

Which plan diagram shows the tissues in a major vein?

The circulatory system

Ventricular septal defect (VSD) is a heart defect present at birth. In VSD, there is a hole in the wall (septum) that divides the left and right ventricles. What might occur in a person with VSD?

The heart

The diagram illustrates variations in pressure in some structures on the right side of the heart during the cardiac cycle. Which structure is labelled X?

The heart

The diagram illustrates a cross-section of a kind of epithelium. In which part of the respiratory system is this type of epithelium located?

The gas exchange system

In chronic obstructive pulmonary disease (COPD), the movement of air through the airways is reduced. Which statements account for the reduced airflow?

The gas exchange system

Cholera outbreaks often arise in refugee camps established after a major natural disaster, such as earthquakes. The list below gives some actions that can be used to reduce the spread of cholera in the refugee camps. Which of these control measures involve an economic factor?

Infectious diseases

Which use of antibiotics helps to lower the spread of resistance in bacteria?

Antibiotics

The graph illustrates the quantity of antibody produced in response to an antigen. From the graph, which statement is correct?

Proteins

Which sequence outlines the hybridoma method used to produce monoclonal antibodies?

Proteins

Four students had to link each function to the appearance of certain cell structures in an animal cell. The functions were numbered as follows: 1 mRNA passes through to the ribosome 2 synthesis of polypeptides 3 packaging of hydrolytic enzymes that will remain in the cell The appearances were labelled with letters: V membranes that enclose an inner cavity W spherical structures with no membrane bound around them X a double membrane with pores running through it Y cylindrical structures with no membrane bound around them Z membrane-bound sacs, arranged in a flattened stack Which student made the correct matches between the numbered functions and the appearance of the cell structure?

Cells as the basic units of living organisms

The smallpox vaccination programme was a major achievement in medicine, and it led the World Health Organisation to declare in 1980 that the world was free of smallpox. Which statement most accurately shows why the smallpox vaccination programme was successful?

Antibodies and vaccination

The antibiotic chloramphenicol prevents protein synthesis in mitochondria and in some prokaryotes. Chloramphenicol does not prevent protein synthesis in the cytoplasm of eukaryotic cells. What effect would this have on the cells of a person being treated with chloramphenicol?

Protein synthesis

The diagram illustrates the monosaccharide xylose. Many xylose monomers may be linked together by glycosidic bonds to make a polysaccharide that is present in plant cell walls. Which diagram shows how a glycosidic bond forms between two xylose monomers?

Carbohydrates and lipids

Which colour shows that the solution contains the least concentration of reducing sugar after it has been tested with Benedict’s solution?

Testing for biological molecules

Which of these molecules are monomers?

Carbohydrates and lipids

Which molecules have characteristics that depend on hydrogen bonding?

Water

A student was calibrating the scale on an eyepiece graticule in the eyepiece lens of a light microscope. A stage micrometer scale was supplied for use. The divisions on the stage micrometer scale were $0.1\ \text{mm}$ apart. Which data does the student need to collect to calibrate the eyepiece graticule?

The microscope in cell studies

The diagram illustrates the formation of a biological macromolecule. What type of bonds are produced in the macromolecule product?

Proteins

Fibrous proteins consist of amino acid chains joined together by bonds. A section of a fibrous protein is illustrated. At X and Y, which type of bond is present?

Proteins

Which row is correct about the structure of proteins?

Proteins

A student has written four statements about water. Which of these statements are correct?

Water

Which statement concerning the active site of an enzyme is correct?

Mode of action of enzymes

In an investigation into the rate of reaction of the enzyme lipase during the hydrolysis of triglycerides, pH has to be kept at an optimum so that the lipase does not denature. What is the reason for this?

Factors that affect enzyme action

An investigation was done to compare how pH affected the activity of an enzyme in solution and the same enzyme after it had been immobilised on a gel. All other variables were kept constant. The results are shown in the graph. Which statement accounts for these results when the enzyme is immobilised?

Factors that affect enzyme action

High concentrations of ethanol can disturb the arrangement of the cell membrane and make the cell surface membrane leaky. Yeast cells produce ethanol as a waste product of metabolism. Yeast cells are able to change the composition of the cell surface membrane to lessen the effect of ethanol. • Saturated fatty acid, X, is substituted with unsaturated fatty acid, Y. • Y has a shorter hydrocarbon chain than X. • The phospholipid to protein ratio increases. Which statement would explain why the effect of ethanol is reduced?

Fluid mosaic membranes

The photomicrograph shows the appearance of onion epidermal cells after they have been left in solution X for one hour. What substance occupies the space labelled Y?

Movement into and out of cells

Potato pieces of the same size were put into a test-tube and immersed in a sucrose solution. The test tube was left standing for 30 minutes. Every other variable was kept constant. After 30 minutes, the potato piece had remained the same size. What can be concluded from this result?

Movement into and out of cells

Cell diameters can differ widely. A typical eukaryotic cell has a diameter of $1.5 \times 10^{1}\ \mu\text{m}$. A typical prokaryotic cell has a diameter of $7.5 \times 10^{2}\ \text{nm}$. From these values, determine the greatest number of cells of each type that could be arranged along a straight line measuring $1\ \text{cm}$ in length.

The microscope in cell studies

Which row gives the correct quantity of each component of one chromosome during prophase of mitosis?

Chromosome behaviour in mitosis

The cell cycle contains mitosis. Which of these are characteristics of nuclear division?

Chromosome behaviour in mitosis

The RNA triplet UAG functions as a stop codon, bringing polypeptide synthesis to an end. The diagram shows a DNA strand that codes for four amino acids. At which position would insertion of a thymine nucleotide cause translation to stop?

Proteins

Which statement is correct about uracil?

Proteins

The photomicrograph displays a vascular bundle. Which statement describes the relationship of water potential in the labelled cells?

Movement into and out of cells

Which features play a part in the transport of water through xylem vessel elements?

Structure of transport tissues

What does transpiration mean?

Movement into and out of cells

What is found in the walls of arteries?

Proteins

The statements below show some of the events in the cardiac cycle, but they are not arranged in the correct sequence. Which statement describes the fifth event to happen in the cardiac cycle?

The heart

In which row are the molecules or cells in the different locations identified correctly?

The microscope in cell studies

Which structures occur in both animal cells and plant cells?

Cells as the basic units of living organisms

When active tissues have high carbon dioxide concentrations, oxyhaemoglobin releases oxygen to these tissues. What promotes this release in the presence of high carbon dioxide concentrations?

Proteins

The graph displays oxygen dissociation curves for haemoglobin at two different carbon dioxide concentrations. In the lungs, the partial pressure of oxygen is $100\,\text{mmHg}$. In metabolically active tissues, the partial pressure of oxygen is $35\,\text{mmHg}$. What percentage saturation of haemoglobin with oxygen is found at the lungs and in metabolically active tissues?

Proteins

Which of the following statements is correct?

Cells as the basic units of living organisms

Four cell types from the gas exchange system are shown below. J alveolus epithelium cell K ciliated cell L goblet cell M smooth muscle cell The ticks ($\checkmark$) in the table indicate specialised features of three of these cell types. Which row correctly pairs the specialised feature with the right cell?

The gas exchange system

A number of symptoms of chronic obstructive pulmonary disease (COPD) are shown below. 1 bursting of alveoli 2 loss of elastic fibres 3 increase in secretion of mucus 4 reduction in surface area for gaseous exchange 5 narrowing of airways Which of these are also symptoms of emphysema?

The microscope in cell studies

The diagram illustrates characteristics of diseases. Which option shows the characteristics that tuberculosis (TB) and measles have in common?

Infectious diseases

The diagram displays several pathogens that lead to disease in humans, together with some of the ways they spread. Which pathogen and transmission route are correct for cholera?

Infectious diseases

Antibiotics work in different ways. It is essential that an antibiotic destroys the bacteria without injuring the infected human. The antibiotic tetracycline has been discovered to influence the way human mitochondria work. Which statements could account for human mitochondria function being affected by tetracycline?

Antibiotics

The immune response following vaccination against a virus can be evaluated using three measurements: 1 the concentration of anti-virus antibody in the blood 2 the time taken for the antibody concentration to rise significantly after a booster vaccination 3 the number of virus-specific lymphocytes per $\text{cm}^3$ blood. What does this indicate about an individual’s immunity when the values for 1, 2 and 3 are all low ten years after vaccination?

Antibodies and vaccination

The enzyme telomerase stops telomeres from being lost after many mitotic cell cycles. Which types of white blood cell involved in an autoimmune condition will contain active telomerase?

Replication and division of nuclei and cells

Which of the features shown in the diagram may be found in eukaryotes?

Cells as the basic units of living organisms

Which characteristics of monoclonal antibodies make them useful for diagnosing and treating disease?

Proteins

Four students were asked to pair each function with the correct appearance of certain cell structures in an animal cell. The functions were given as numbers: 1 organises microtubules to form the spindle during cell division; 2 synthesis of polypeptides; 3 synthesis of lipids. The appearances were given as letters: V membranes enclosing an inner cavity; W non-membrane bound, spherical structures; X a double membrane with pores; Y non-membrane bound, cylindrical structures; Z membrane-bound sacs arranged as a flattened stack. Which student made the correct pairing between the numbered functions and the appearance of the cell structure?

Cells as the basic units of living organisms

What types of RNA occur in prokaryotic cells and in eukaryotic cells?

Protein synthesis

A student performed four tests for biological molecules on a solution. The table lists the results: iodine test gives orange-brown; biuret test gives purple; Benedict’s test gives orange; emulsion test gives clear. Which three molecules could be present in this solution?

Testing for biological molecules

A student needed to estimate the concentration of reducing sugar in an unknown solution by using the Benedict’s test. Five reducing sugar solutions of different concentrations were supplied to help generate a calibration curve. The student added $2\ \text{cm}^3$ of Benedict’s solution to each reducing sugar solution, heated the mixtures in a water-bath and noted the time for the first colour change to appear. Which variables should the student keep constant while carrying out the Benedict’s test on each reducing sugar solution so that the results can be compared fairly?

Testing for biological molecules

Which rows indicate the chemical groups found in the biological molecules listed?

Testing for biological molecules

Plant cells are stained and then observed with a simple light microscope, with daylight as the only source of light. Which cell structures are clearly visible at a magnification of $\times 400$?

The microscope in cell studies

The diagrams illustrate the structure of an amino acid, with certain parts of the molecule shaded. Which diagram shows the shaded section of the molecule that is present in every amino acid?

Proteins

Some extracellular protease enzymes are made in an inactive form known as zymogen. Zymogen is changed into the active protease in the Golgi body. What is the purpose of making zymogen before it is converted into the extracellular protease?

Mode of action of enzymes

In an enzyme-catalysed reaction, the Michaelis-Menten constant is written as $K_m$, while the highest reaction velocity is called $V_{max}$. Which of the following statements about $K_m$ and $V_{max}$ is correct?

Mode of action of enzymes

The diagram shows part of the fluid mosaic model of a cell surface membrane. Which sections of the membrane are hydrophilic?

Fluid mosaic membranes

Which of the following statements about proteins and glycoproteins in cell surface membranes are correct?

Fluid mosaic membranes

Which pair of factors shows an inverse relationship with the rate of diffusion?

Movement into and out of cells

Raisins are dried fruits with a high concentration of sugar. Which row is correct when raisins are first placed in water?

Movement into and out of cells

Which processes that take place in cell division are shown in the diagram? The diagram plots mass of nuclear DNA in a cell / arbitrary units against time.

Replication and division of nuclei and cells

During mitosis of a cancer cell, what happens to the telomeres?

Chromosome behaviour in mitosis

The graph displays three measurements taken after metaphase in mitosis. Which measurements do the curves show?

Chromosome behaviour in mitosis

How many nanometres are contained in one millimetre?

The microscope in cell studies

The diagram shows a nucleotide that contains guanine. Which of the following statements about this nucleotide are correct?

Structure of nucleic acids and replication of DNA

What is the greatest number of codon-anticodon interactions that can occur inside a single ribosome?

Proteins

Meselson and Stahl studied DNA in bacteria. They first grew the bacteria in a medium containing only heavy nitrogen, $^{15}\text{N}$, until every bacterial DNA molecule was heavy. The bacteria were then transferred from the heavy nitrogen medium to a medium containing only light nitrogen, $^{14}\text{N}$. A sample of bacteria was taken from the first generation and the DNA was examined. Hybrid DNA is made up of heavy DNA and light DNA. Which row gives the percentage of light DNA strands and the percentage of hybrid DNA molecules in the first generation produced in the medium containing light nitrogen?

Replication and division of nuclei and cells

Which statements about tRNA structure are correct?

Proteins

Which row identifies why xylem vessels do not contain cytoplasm?

Structure of transport tissues

What makes water move from the root hair cells to the endodermis?

Movement into and out of cells

Which statement is correct about a Casparian strip?

Movement into and out of cells

Which xerophytic adaptations decrease the water potential gradient from the leaf surface to the atmosphere?

Movement into and out of cells

When sucrose is loaded into the phloem, it must first move out of mesophyll cells, then into a companion cell, before reaching the phloem. In many plants, proton pumps and co-transporter molecules help to carry out this process. Which row indicates the relative concentrations of sucrose in each type of cell?

Movement into and out of cells

The diagram shows three white blood cells labelled X, Y and Z. Which row correctly names these cells?

The immune system

Which cell structures have $70\text{S}$ ribosomes?

Protein synthesis

What is the correct order in which the valves of the mammalian heart open during one cardiac cycle?

The heart

Red blood cells can contain a molecule called 2,3-bisphosphoglycerate (2,3-BPG). If 2,3-BPG binds to haemoglobin, a greater partial pressure of oxygen is required to achieve $50\%$ saturation of haemoglobin with oxygen. Which statements concerning the effect of 2,3-BPG are correct?

Proteins

Aortic stenosis is a disorder of a heart valve where the opening of the aortic semilunar valve becomes narrow. What effect might aortic stenosis have on heart structure and function?

The heart

What accounts for the increase in the red blood cell count of humans when they stay at high altitudes?

Replication and division of nuclei and cells

Which structure may include ciliated epithelium?

The gas exchange system

Which row indicates the effects of chronic bronchitis?

The gas exchange system

The statements are about the disease tuberculosis (TB). Which statement explains why antibiotic treatment for TB lasts a long time?

Replication and division of nuclei and cells

Scientists investigated multidrug resistant bacterial infections in children, which were caused by one type of bacteria, during 2007 and 2015. The proportion of multidrug resistant infections increased from $0.2\%$ to $1.5\%$. What was the percentage increase in multidrug resistant infections between 2007 and 2015?

Antibiotics

Why does someone who has a bacterial infection need to take antibiotics at regular, evenly spaced intervals?

Factors that affect enzyme action

Telomerase stops telomere shortening after numerous mitotic cell cycles. Three cell types are used to make monoclonal antibodies. Which cells in this technique have active telomerase enzyme?

Replication and division of nuclei and cells

The electron micrograph illustrates a section of a plant cell (scale bar $5\,\mu\text{m}$). Which option correctly names the labelled cell structures P, Q, R and S?

Cells as the basic units of living organisms

Why are monoclonal antibodies useful for diagnosing disease?

Proteins

Four students were asked to match the function to the appearance of some cell structures in an animal cell. Which student correctly matched the numbered function to the appearance of the cell structure?

Cells as the basic units of living organisms

Investigations for biological molecules were done on food samples. Which option correctly pairs the biological molecules present in the food samples with the colour that shows a positive result?

Testing for biological molecules

What takes place when a glycosidic bond is formed between two $\alpha$-glucose molecules?

Carbohydrates and lipids

What is the greatest number of condensation reactions that take place when a triglyceride is formed?

Carbohydrates and lipids

Three proteins with a quaternary structure are shown. • Type IX collagen is assembled from three different polymers. • The principal form of haemoglobin has two alpha globins and two beta globins. • HIV protease is composed of two identical polymers. Which row gives the correct number of genes required to code for each protein?

Proteins