Biology 9700 · AS & A Level · Proteins

Proteins — practice question

Sickle cell anaemia results from a mutation in an allele of the gene that specifies the $\beta$-globin polypeptide in haemoglobin. The diagram below shows the base sequence in a short section of the coding strand of DNA for both the $Hb^A$ (normal) and $Hb^S$ (sickle cell) $\beta$-globin alleles. $Hb^A$: CTGACTCCTGAGGAGAAGTCT $Hb^S$: CTGACTCCTGTGGAGAAGTCT How will the mutation in the allele cause production of an altered form of the $\beta$-globin polypeptide?

  • AA tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA.
  • BAll the amino acids coded for after the mutation will differ from those in the $Hb^A$ protein.
  • CmRNA transcribed from the $Hb^S$ allele will contain the codon CAC instead of the codon CTC.
  • DThe ribosome will be unable to continue translation of the $Hb^S$ mRNA after the altered codon.

Worked solution & mark scheme

This 1-mark question has a full step-by-step worked solution and mark scheme.

  • Full mark scheme, point by point
  • Step-by-step worked solution
  • Write your answer & get it marked instantly by AI